More results...

Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
post
page
Python IDE Dashboard

Bonsai Haven – CSS Task

Welcome to this exciting web design programming challenge designed to enhance your CSS skills. Today you’ll be working on the home page of an online shop called Bonsai Haven, an online store specialising in selling beautiful bonsai trees.

In this challenge, you will be provided with the HTML and JavaScript code for the home page of the online shop as well as a partially completed CSS file to give the page the desired look & feel. Your task is to complete the CSS to match the provided design image. This exercise will help you practice and refine your CSS skills, including layout design, styling of text pictures and buttons, and responsiveness.

Intended Home Page Design

Here is a picture of the intended final look & feel for the home page of Bonsai Haven:

CSS Syntax

A CSS rule consists of a selector and a declaration block. The declaration block contains one or more declarations separated by semicolons. Each declaration includes a CSS property name and a value, separated by a colon.

Here’s an example of a CSS rule that uses a class selector and applies several properties:

.my-class {
    color: #ff0000;
    font-size: 16px;
    margin: 10px 20px;
    padding: 20px;
    border: 1px solid black;
}

In this example, all elements with the class my-class will have red text, a font size of 16 pixels, a margin of 10 pixels (top and bottom) and 20 pixels (left and right), padding of 20 pixels, and a solid black border.

To Do List

You will complete this task step by step by adding CSS properties to apply formatting options to the relevant sections of the page. The HTML/CSS code is provided at the bottom of this page and you will be able to edit the CSS code online.

In order to complete this task you will need to familiarise yourself and research the main CSS properties using the following CSS tutorial from w3schools.

Complete each action from the following 2 tabs:

Body and Header SectionCategories / Navigation ButtonsProduct Cards
First we will focus on the main body and the top section of the page:

  • Body of the page:
      Apply a padding of 30 pixels to the body of the page
      Change the font colour to #303030
      Change the background colour to #335625
      Change the font to Raleway, sans-serif
  • Shop container:
      Set the maximum width of this element to 1400 pixels
      Set the margin to 40px (top and bottom) and auto (left and right) to center the shop on the page.
  • Shop header:
      Apply a white colour to the text
      Apply a bottom margin of 40 pixels
  • h1 tag within the shop-header:
      Change the size of the text to 3.5rem
      Apply a bottom margin of 20 pixels
  • p tag within the shop header
      Change the size of the text to 1.6rem
      Change the opacity of this element to 0.8;
      Set the maximum width attribute to 800 pixels
      Apply the Caveat, cursive font to this element
Let’s now focus on the 4 navigation buttons used to select a category of trees.

  • Categories section:
      Set a margin to 20 pixels (top and bottom) and 0 pixel (left and right)
  • Category buttons:
      Set a right margin of 15 pixels
      Set the padding to 10 pixels (top and bottom) and 20 pixels (left and right)
      Change the border radius to 25 pixels
      Apply a background colour using the following rgba code: (255,255,255,0.1)
      Apply a 1 p pixel solid border with a colour using the following rgba code: (255,255,255,0.2)
      Apply a white colour to the text
      Change the mouse cursor to display a pointer
Now let’s focus on formatting the product cards:

  • Products Grid Section:
      Change the gap to 20 pixels
  • Product Card Section:
      Change the background colour to white
      Set the border radius to 15 pixels
      Add a shadow effect using your own choice of settings for the shadow
  • Product Details Section:
      Add a padding of 25 pixels
  • Product Name Section:
      Change the font to Raleway, sans-serif
      Change size of the text to 1.5rem
      Add a bottom margin of 10 pixels
  • Product Description Section:
      Set the colour of the text to #666
      Set the line height property to 1.4
      Add a bottom margin of 20 pixels
  • Product Price Section:
      Set the colour of the text to #58873d
      Change size of the text to 1.5rem
      Set the font weight to bold
  • Add to Cart button:
      Set the background colour to #58873d
      Set the padding to 12 pixels (top and bottom) and 25 pixels (left and right)
      Set the border radius to 25 pixels
      Remove the border (set the border property to none)
      Change the mouse cursor to display a pointer
      Change the background colour to #70a751 when the user hovers over the button

HTML / CSS Code

You can edit this code in a new window using this button:

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area
Tagged with:

Stargate Access Code – Python Chalenge


You are aboard a state-of-the-art spaceship, a few million light-years away from planet Earth, hurtling through the cosmos on a critical mission. Following a system outage, the AI on board went into shutdown mode and locked all doors onboard the spaceship. You are now standing up in front of a locked door that blocks access to the main command centre of the ship. On the side of the door is a digital screen displaying a 6-digit number and a keypad with the 26 letters of the alphabet. Your mission, should you choose to accept it, is to unlock the door by entering a valid 3-letter combination.

How to break the code and find the 3-letter access code to unlock the gate?
The access code you need to guess is a 3-letter combination. When you multiply the ASCII values of each letter in the combination, you must get the 6-digit number displayed on the screen.

ASCII Values?

ASCII (American Standard Code for Information Interchange) values are numerical representations of characters. For example, the ASCII value of ‘A’ is 65, ‘B’ is 66, and so on. In Python, you can get the ASCII value of a character using the ord() function. You can also use the chr() function to retrieve the character matching a given ASCII value.

ascii = ord("A") # 65
print("The ASCII value for character A is :" + str(ascii))

letter = chr(90)  # Z
print("90 is the ASCII cvalue for letter " + letter)) 

Python Challenge

To solve this challenge, you will write a Python script that finds the 3-letter combination to unlock the door. Let’s dive into the world of ASCII values, loops, and a bit of mathematical magic to crack the code! Below is the digital panel to control the gate. Underneath is the Python IDE you will use to write the code to find a valid 3-letter combination.

Approach to the Solution

To solve this problem, you will use a brute-force approach. Your Python program will need to iterate through all possible 3-letter combinations of the alphabet from AAA to ZZZ and calculate the product of their ASCII values. If the product matches the given 6-digit number, your algorithm has found a valid combination!

Here’s a step-by-step outline of this approach:

  1. Generate Three-Letter Combinations: Use nested loops to generate all possible combinations of three letters. Remember, in ASCCI letter A is 65 and letter Z is 90. Use this information to implement your nested for loops.
  2. Calculate the Product of ASCII Values: For each combination, calculate the product of the ASCII values of the three letters.
  3. Compare the Product to the Given Number: If the product matches the given 6-digit number, print the combination.

Door Access Panel

Python IDE

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

Stranger Code Challenge

Welcome to our latest programming challenge! This time, we’re diving into the world of Stranger Things and the challenge is based on a piece of code seen in the second series of Stranger Things (Episode 8) where, following a total blackout, some of the characters of the series are trapped inside Hawkins Lab, a secretive governmental laboratory. In order to hack into the central computer system, Bob, one of the beloved characters, has to write some code in BASIC to find the 4-digit passcode needed to access Hawkins Lab’s door access system. The code seen on the screen is written in BASIC, a programming languages used in the 1980s’. The aim of this programming challenge will be to rewrite this code in Python.

The code written by Bob is used to implement a brute force attack to test all possible combinations of 4-digit codes from 0000 to 9999 until the right passcode is found. Here is the code seen on Bob’s screen:

10 DIM FourDigitPassword INTEGER
20 FOR i = 0 TO 9
30     FOR j = 0 TO 9
40          FOR k = 0 TO 9
50                FOR l = 0 TO 9
60                      FourDigitPassword = getFourDigits (i,j,k,l)
70                      IF checkPasswordMatch(FourDigitPassword) = TRUE THEN
80                              GOTO 140
90                      END
100                NEXT l
110          NEXT k
120     NEXT j
130 NEXT i
140 PRINT FourDigitPassword
150 END

The code provided shows two functions being called: getFourDigit(i, j, k, l) on line 60 and checkPasswordMatch(FourDigitPassword) on line 70. We will assume that these

  • getFourDigit(i, j, k, l): This function takes four digits as parameters and returns a 4-digit integer. For example, if the inputs are 3, 4, 5, 6, the function should return 3456.
  • checkPasswordMatch(FourDigitPassword): This function takes a 4-digit integer and returns True if the parameter passed is the correct password, otherwise it returns False.

We will assume these two functions are part of the Hawkins Lab central computer system and we will use an import statement in Python to import and use these. However it will be part of the programming challenge to complete the code for these two functions.

Your Task

You will need to complete this task in three steps as follows:

Go into the hawkins_lab.py file in the Python IDE provided below and complete the code for the getFourDigit() function. The aim of this function is to take four integer as parameters (e.g. 3, 4, 5 and 6) and return a 4-digit integer (e.g. 3456)

Within the hawkins_lab.py file, complete the code for the checkPasswordMatch() function. The aim of this function is to take a 4-digit integer (e.g. 3456) as a parameter and compare it with the actual passcode to give access to the door access system. The correct passcode will be hardcoded within this function as 1984. If the password passed as a parameter is a match (=1984) then the function will return True, otherwise it will return False.

In the main.py file, rewrite the main code in Python from Bob’s code provided in BASIC. This is the code used to implement the Brute Force Attack to test all 4-digit passcodes from 0000 to 9999 using 4 nested loops and the two functions from hawkins-lab.py.

Python Code

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

The Uses and Characteristics of Graphics Processing Units (GPUs)

A Graphics Processing Unit (GPU) is a specialised electronic circuit designed to rapidly manipulate and alter memory to perform complex calculations on large data sets and/or to accelerate the creation of images in a frame buffer intended for output to a display device. Unlike Central Processing Units (CPUs), which are optimised for sequential processing, GPUs excel at performing multiple calculations simultaneously. This parallel processing capability makes GPUs particularly adept at handling tasks that require large amounts of data to be processed in parallel.

Characteristics of GPUs

  1. Parallel Processing: GPUs are composed of thousands of smaller, more efficient cores designed for handling multiple tasks simultaneously. This is in stark contrast to CPUs, which typically have fewer, more powerful cores optimised for sequential processing.

  2. High Memory Bandwidth: GPUs are equipped with high memory bandwidth, allowing them to quickly access and process large datasets. This is crucial for tasks that involve extensive data manipulation, such as rendering high-definition graphics or performing complex mathematical computations.

  3. Specialised Architecture: The architecture of a GPU is tailored for tasks that can be broken down into smaller, independent operations. This makes GPUs highly efficient for applications that can leverage parallelism, such as image processing, scientific simulations, and machine learning.

  4. Scalability: GPUs can be combined in clusters to form powerful computing systems capable of handling even the most demanding tasks. This scalability is particularly useful in high-performance computing (HPC) environments, where massive computational power is required.

Purposes of GPUs

  1. Graphics Rendering: The primary purpose of GPUs is to render graphics. They are used in everything from video games to professional graphic design software. By offloading graphics rendering tasks from the CPU, GPUs enable smoother and more detailed visual experiences.

    • Example: In video games, GPUs render complex 3D environments in real-time, providing players with immersive and visually stunning experiences. Games like “Forza Horizon 5” and “Call of Duty: Warzone” rely heavily on GPUs to deliver high-quality graphics and smooth gameplay.
  2. Scientific Simulations: GPUs are widely used in scientific research to perform complex simulations. Their parallel processing capabilities allow researchers to model and analyze large datasets quickly and efficiently.

    • Example:  GPUs are increasingly being utilised in the field of weather forecasting and climate modelling to enhance the accuracy and speed of predictions and evaluate or predict the impacts of climate change on our environment. The parallel processing capabilities of GPUs allow meteorologists to run complex numerical weather prediction models more efficiently than traditional CPUs.
  3. Machine Learning and Artificial Intelligence: GPUs play a crucial role in the field of machine learning and artificial intelligence. Training machine learning models involves performing numerous matrix operations, which can be parallelized and accelerated using GPUs.

    • Example: Companies like Google and Facebook use GPUs to train their deep learning models. These models power various AI applications, from image recognition to natural language processing.
  4. Cryptocurrency Mining: GPUs are also used in cryptocurrency mining, where they perform the complex mathematical calculations required to validate transactions and secure blockchain networks.

    • Example: In the early days of Bitcoin, GPUs were commonly used for mining due to their ability to perform multiple calculations simultaneously. While specialized hardware like ASICs (Application-Specific Integrated Circuits) has largely taken over, GPUs are still used for mining other cryptocurrencies.
  5. Medical Imaging: In the medical field, GPUs are used to process and analyse medical images. Their parallel processing capabilities enable faster and more accurate diagnoses.

    • Example: In MRI (Magnetic Resonance Imaging) and CT (Computed Tomography) scans, GPUs are used to reconstruct 3D images from 2D slices. This allows doctors to visualise and analyse internal structures with greater precision.

Conclusion

Graphics Processing Units (GPUs) are a cornerstone of modern computing, offering high performing parallel processing capabilities that enhance a wide range of applications. From graphics rendering and scientific simulations to machine learning and medical imaging, GPUs are transforming the way we interact with and understand the world.

As technology continues to advance, the role of GPUs will only become more prominent. By mastering the principles of parallel processing and leveraging the power of GPUs, the next generation of computer scientists can push the boundaries of what is possible, driving innovation and shaping the future of computing.

Software Development Methodologies

Software development methodologies are structured approaches to the process of creating software. They provide a framework that guides business analysts, system designers, software developers, system testers and project managers through the various stages of software development, from initial concept to final product. These methodologies help ensure that software projects are completed efficiently, within budget, and to the required quality standards. They enable teams to collaborate more effectively and can be broadly categorised into two types: traditional (e.g. The Waterfall Model, spiral model) and agile methodologies (e.g. Rapid Application Development, Extreme Programming, Scrum).

The Waterfall Model

The Waterfall model is one of the earliest and most straightforward software development methodologies. It is a linear and sequential approach, where each phase must be completed before the next one begins. The Waterfall model consists of the following stages:

  1. Requirements Gathering and Analysis: This initial phase involves collecting and analysing the requirements of the software. Developers work closely with stakeholders to understand what the software needs to accomplish.
  2. System Design: In this phase, the overall architecture of the software is designed. This includes defining the system’s components, their interactions, and the technologies to be used.
  3. Implementation: During this stage, the actual coding of the software takes place. Developers write the code based on the design specifications.
  4. Testing: Once the coding is complete, the software is tested to identify and fix any bugs or issues. This phase ensures that the software meets the specified requirements and functions correctly.
  5. Deployment: After successful testing, the software is deployed to the production environment where it will be used by end-users.
  6. Maintenance: This final phase involves maintaining the software, fixing any issues that arise, and making updates or improvements as needed.

Benefits of the Waterfall Model:

  • Simple and easy to manage.
  • Clearly defined roles, milestones and deliverables.
  • Well-documented process.
  • Suitable for projects with well-defined requirements.

Drawbacks of the Waterfall Model:

  • Inflexible and difficult to accommodate changes once a phase is completed.
  • Late testing can lead to the discovery of major issues late in the development process.
  • Not suitable for projects where requirements are likely to change or where requirements cannot be fully defined early on in the project.

Agile Methodologies

Agile methodologies are iterative and incremental approaches to software development. They emphasise flexibility, collaboration, and customer feedback. It breaks down large projects into smaller, manageable iterative cycles (sprints) to deliver incremental value and respond to changing requirements. Unlike the Waterfall model, agile methodologies allow for changes to be made throughout the development process.

Rapid Application Development and Extreme Programming are two examples of agile methodologies:

Rapid Application Development (RAD)

Rapid Application Development (RAD) is an agile software development methodology that emphasises an iterative approach and the use of prototypes. Unlike traditional methodologies that rely on rigid planning and sequential phases, RAD focuses on quickly developing and refining prototypes based on user feedback. This iterative process allows for continuous improvement and adaptation, making it easier to accommodate changes and ensure that the final product meets user needs.

Key Phases of RAD:

  1. Requirement Analysis: This initial phase involves understanding the main aims and scope of the system to be developed and to identify its key requirements.
  2. Iterative Development (Prototypes Cycle): During this stage, the actual software is developed in multiple stages/prototypes using an iterative approach. The software prototypes are tested rigorously to identify and fix any issues. Prototypes can be demonstrated to the customer and user feedback is collected and used to refine the prototypes. This phase is iterative, meaning that the prototypes go through multiple cycles of testing and refinement until they meet the desired quality standards.
  3. Final Testing & Deployment: Once the final product is ready, after a final stage of testing, it is deployed to the production environment.

Benefits of RAD:

  • Flexible User Requirements: The User requirements don’t need to be fully defined from the start. They can evolve throughout the project based on customer feedback.
  • Quick Development and Iteration: RAD’s iterative approach allows for rapid development and continuous improvement. This makes it easier to adapt to changing requirements and ensures that the final product is closely aligned with user needs.
  • High Level of Customer Involvement and Feedback: RAD emphasises customer involvement throughout the development process. Regular feedback from users helps to identify issues early and ensures that the software meets their expectations.
  • Quick deliveries: With this approach, it is possible to deliver and deploy prototypes within shorter deadlines without the need to wait for the full system to be completed.

Drawbacks of RAD:

  • Resource-Intensive: RAD may be more complex to implement than using the Waterfall model. It requires more time spent on project planning and the need to organise regular contact with the customer throughout the whole process.
  • Not Suitable for Large-Scale Projects: RAD is best suited for smaller projects or projects that can be broken down into smaller components. It may not be suitable for large-scale projects with complex requirements that would need to be clearly defined from the start to allocate tasks and resources to all the teams involved. Changing requirements may also add extra delays to the overall length of the project.
  • Potential Lack of Documentation: The focus on rapid development and iteration can sometimes lead to a lack of comprehensive documentation, which can be a challenge for maintenance and future updates.

By focusing on an iterative approach and the use of prototypes, RAD provides a flexible and adaptive framework for software development. This makes it an excellent choice for projects where user feedback and rapid iteration are critical to success.

Extreme Programming (XP)


Extreme Programming (XP) is an agile methodology that emphasises on the programming stage to produce high quality code in very short deadlines using a collaborative and iterative approach allowing for continuous improvement. XP consists of the following practices:

  1. Pair Programming: Two developers work together at one workstation, with one writing the code and the other reviewing it.
  2. Test-Driven Development (TDD): Tests are written before the code, and the code is then developed to pass the tests resulting in robust/reliable code being produced.
  3. Customer Involvement: Customers are actively involved in the development process, providing feedback and prioritising features.

Benefits of XP:

  • High-quality code due to continuous testing and refining and the use of pair-programming approach.
  • High level of customer involvement and satisfaction.
  • Suitable for projects with changing requirements.

Drawbacks of XP:

  • Can be resource-intensive and need a team of programmers who can work in close collaboration. Unlikely to work well if the team is widely distributed geographically on different time zones or speaking different languages.
  • Not suitable for projects with strict requirements.

Spiral Model

The Spiral model is an agile methodology that combines iterative development with systematic aspects of the Waterfall model. It consists of the following phases:

  1. Planning: This phase involves identifying the objectives, alternatives, and constraints of the project.
  2. Risk Analysis: In this phase, potential risks are identified and analysed, and strategies for mitigating them are developed. A feasibility study is performed to identify risks associated with the scope of the project (is the system produced going to meet the defined user requirements), costs (is the project  likely to go over budget), timescales (is the project going to meet the set deadlines), resources (do we have the resources and right skills / work force to complete the project)  and other aspects which could impact the feasibility of the project (technological developments, legal considerations, etc.)
  3. Engineering: During this stage, the software is developed and tested.
  4. Evaluation: The software is evaluated by the customer, and feedback is collected for the next iteration.

Benefits of the Spiral Model:

  • High level of risk management enabling to identify early enough potential risks and minimise their impacts on the project.
  • Suitable for large-scale and complex, costly projects.
  • Flexible and adaptable to changes.

Drawbacks of the Spiral Model:

  • Can be complex and difficult to manage.
  • Requires a high level of expertise and resources.
  • Not suitable for small-scale projects.

Conclusion

Software development methodologies are structured approaches to the process of creating software. Whereas the Waterfall model provides a structured and linear approach to software development, while other iterative approaches like the Spiral model or agile methodologies such as Rapid Application Development and Extreme Programming offer flexibility and adaptability. Each methodology has its benefits and drawbacks, and the choice of methodology depends on the specific requirements and constraints of the project.

 

The Florist’s Colourful Bouquet Composer – Python Challenge

Welcome to this Python challenge! This time, we are going to help a florist compose beautiful, colourful bouquets for their customers. Your task is to write a Python program that recommends different flowers based on the colours the customer wants and the number of different flowers they would like in their bouquet.

The program should:

  1. Ask the user for the colours they want in their bouquet.
  2. Ask the user for the number of different flowers they want in their bouquet.
  3. Suggest a selection of flowers that match the requested colours and number.

For instance, if the user wants a red, purple and yellow bouquet with 5 different types of flowers, the program might suggest:

  • Red Tulips
  • Red Poppies
  • Purple Wisteria
  • Purple Orchids
  • Yellow Daffodils

Getting Started

To complete this challenge we will use a dictionary data structure. The keys of our dictionary will be the different colours. For each colour, our dictionary will store a list of flowers matching the colour.

Here’s our dictionary data structure called flowers:

flowers = {
    "Red": ["Rose", "Tulip", "Carnation", "Geranium", "Poppy", "Amaryllis", "Anemone", "Camellia"],
    "Purple": ["Lilac", "Orchid", "Lavender", "Allium", "Clematis", "Bellflower", "Iris", "Wisteria"],
    "Yellow": ["Sunflower", "Daffodil", "Marigold", "Dahlia", "Tulip", "Buttercup", "Goldenrod", "Forsythia"],
    "Blue": ["Bluebell", "Cornflower", "Delphinium", "Hydrangea", "Iris", "Periwinkle", "Forget-me-not", "Agapanthus"],
    "White": ["Lily", "Jasmine", "Daisy", "Gardenia", "Baby's Breath", "Magnolia", "Peony", "Snowdrop"],
    "Pink": ["Peony", "Cherry Blossom", "Azalea", "Carnation", "Begonia", "Camellia", "Dahlia", "Foxglove"],
    "Orange": ["Marigold", "Zinnia", "Nasturtium", "Buttercup", "Bird of Paradise", "Calendula", "Geum", "Tiger Lily"],
    "Green": ["Green Rose", "Bells of Ireland", "Green Hydrangea", "Green Zinnia", "Green Carnations", "Green Chrysanthemum"],
    "Black": ["Black Dahlia", "Black Rose", "Black Callas", "Black Pansy", "Black Tulip"],
    "Brown": ["Chocolate Cosmos", "Brown-Eyed Susan", "Cattail", "Brown Orchid"]
}

Python Code

Here’s a basic outline of how your program might look:

     Input: Ask the user for the colours and the number of flowers.
     Process: Use the input to select flowers from your dictionary. Randomly selecting flowers from the list for a given colour will provide more variety in the suggestions made by your program.
     Output: Print the suggested bouquet.

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

How tall is Big Ben? (Python Challenge)

In this blog post we will find an easy method to estimate the height of any high building or tree by measuring the length of its shadow in the ground. We will apply this method to estimate the height of Big Ben, London, UK; technically the Elizabeth Tower, Big Ben being the name of the large bell inside this clock tower. This challenge provides a practical application of similar triangles and basic trigonometry, which are fundamental concepts in geometry.

Similar Triangles Method

To estimate the height of a tree or a building using its shadow, we can use the concept of similar triangles. Here’s a simple diagram to illustrate the method:

The two triangles formed by both the Elizabeth Tower and its shadow and by the phone box and its shadow are similar triangles: two triangles are similar if the angles are the same size. As a consequence, the corresponding sides of these triangles are in the same ratio. We can therefore estimate the height of the clock tower using the following formula:

It’s effectively a lot more practical for anyone to measure the length of a shadow on the ground, and to measure the height of a smaller reference object such as a person or a telephone box, than to measure the actual height of a building!

Python Challenge

Your task is to write a Python program that will:

     Take three inputs: l, h, and L: The length of the telephone box shadow (l), the height of the telephone box (h) and the length of the shadow of the Elizabeth Tower (L)
     Use the three input values to work out the height of the Elizabeth Tower (H)
     Output the estimated height of the Elizabeth Tower to one decimal place.

To test your program use the following values:

Can you then use your program to estimate the height of the Eiffel Tower using a 1.85m tall French man as your reference object and the following shadow measurements:

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

DNA Sequence Analysis – Python Challenge

You are a bioinformatics researcher working on analysing DNA sequences. Your task is to write a Python program that can perform various analyses on a given DNA sequence. The program should be able to count nucleotides, find complementary strands, and identify specific patterns within the DNA sequence.

What is DNA?

DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions used in the growth, development, functioning, and reproduction of all known living organisms and many viruses. DNA is often referred to as the “blueprint of life” because it contains the information needed to build and maintain an organism.

What is a DNA Sequence Made Of?
A DNA sequence is a chain of nucleotides, which are the basic building blocks of DNA. There are four types of nucleotides bases in DNA with different chemical composition::

  • Adenine (A)
  • Thymine (T)
  • Cytosine (C)
  • Guanine (G)

The sequence of these nitrogenous bases along the DNA strand encodes genetic information. The bases pair specifically: Adenine pairs with Thymine (A-T), and Cytosine pairs with Guanine (C-G). This pairing is crucial for the replication and transcription of DNA.

DNA has a double-helix structure, which means it is made up of two long strands that twist around each other like a spiral staircase. Each strand is composed of a sequence of nucleotides, and the two strands are held together by hydrogen bonds between the paired bases.

What is DNA Sequence Analysis used for?

DNA sequence analysis is a fundamental tool in genetic and biological research. It involves examining the nucleotide sequences of DNA to understand genetic information, identify mutations, and study evolutionary relationships. By comparing DNA sequences, researchers can identify genetic variations that may contribute to diseases, track the spread of pathogens, and even trace the evolutionary history of species. Overall, DNS sequence analysis is vital for uncovering the genetic basis of traits and diseases, thereby driving innovations in healthcare, agriculture, and environmental science.

Python Challenges

Use the tabs below to access 5 Python challenges, all based on using string handling techniques to analyse a DNA sequence.

Task 1: Counting NucleotidesTask 2: Finding the Complementary StrandTask 3: Identifying PatternsTask 4: Transcribing DNA to RNATask 5: Calculating GC Content

Task 1: Counting Nucleotides

Write a function called count_nucleotides() that takes a DNA sequence as a parameter and returns a dictionary with the counts of each nucleotide (A, T, C, G).

Example:

dna_sequence = "ATGCGATCCATGACAAT"
nucleotides = count_nucleotides(dna_sequence)
print(nucleotides)
# Output: {'A': 6, 'T': 4, 'C': 4, 'G': 3}

Task 2: Finding the Complementary Strand

Write a function called complementary_strand() that takes a DNA sequence as a parameter and returns its complementary strand. In DNA, the complementary base pairs are A-T and C-G.

Example:

dna_sequence = "ATGCGATTCA"
complementatry_dna_sequence = complementary_strand(dna_sequence)
print(complementatry_dna_sequence)
# Output: "TACGCTAAGT"

Task 3: Identifying Patterns

Within the DNA sequence we can identify patterns for the different amino acids that makes up the DNA. Each amino acid can be identified using a sequence of 3 nucleotides (called a codon).

From the diagram below we can see that the codons GTA, GTC, GTT and GTG are all valid codons for the Valine amino acid whereas AGC and AGT are the codons for Serine.

Write a function called find_pattern() that takes a DNA sequence and a pattern (e.g. a three-letter codon) as parameters, and returns the starting indices of all occurrences of the pattern in the DNA sequence.

Example:

dna_sequence = "ATAGCGATATCGAGCTAC"
pattern = "AGC"
positions = find_pattern(dna_sequence, pattern)
print(positions)
# Output: [2, 12]

Task 4: Transcribing DNA to RNA

DNA (Deoxyribonucleic Acid) is a double-stranded molecule with a deoxyribose sugar and the nitrogenous bases Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). It stores genetic information long-term and is primarily found in the nucleus of cells. RNA (Ribonucleic Acid), on the other hand, is typically single-stranded, contains a ribose sugar, and uses Uracil (U) instead of Thymine. RNA is involved in the transmission and expression of genetic information, playing roles in protein synthesis and gene regulation. DNA is more stable, making it suitable for long-term storage, while RNA is less stable and more reactive, fitting its dynamic roles in cellular processes.

Write a function called transcribe_DNA_to_RNA() that takes a DNA sequence as a parameter and returns the corresponding RNA sequence. In RNA, thymine (T) is replaced by uracil (U).

Example:

dna_sequence = "ATGCTAGCT"
rna_sequence = transcribe_DNA_to_RNA(dna_sequence))
print(rna_sequence)
# Output: "AUGCUAGCU"

Task 5: Calculating GC Content

Write a function called gc_content() that takes a DNA sequence as a parameter and returns the GC content as a percentage. The GC content is the percentage of nucleotides in the DNA sequence that are either G or C.

Example:

dna_sequence = "ATGCGAT"
gc = gc_content(dna_sequence)
print(gc)
# Output: 57.14 %

Python Code

Complete the code for the 6 functions describes above in the following Python IDE:

Here si the expected output for your code:

Expected Output:

DNA Sequence: ATAGCGATCGTAGTTCATAGCTACGTGCGATAGCTCAA
Count Nucleotides: {'A': 11, 'T': 10, 'C': 8, 'G': 9}
Complementary Strand: TATCGCTAGCATCAAGTATCGATGCACGCTATCGAGTT
Find Pattern 'AGC': [2, 18, 31]
Transcribe DNA to RNA: AUAGCGAUCGUAGUUCAUAGCUACGUGCGAUAGCUCAA
GC Content: 44.73684210526316 %
unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

The Archaeologist’s Python Challenge

In this challenge, you will write a Python script to help an archaeologist estimate the age of an artefact using Carbon-14 dating. This method is commonly used in archaeology and is used on organic materials – anything that originate from living organisms including bone, cloth, wood and plant fibres – as old as 60,000 years. Carbon-14 dating works by measuring the amount of Carbon-14, a radioactive isotope of carbon, that remains in the artefact. When an organism dies, it stops taking in new Carbon-14, and the existing Carbon-14 starts to decay at a known rate. By measuring the remaining Carbon-14, scientists can estimate how long ago the organism died.

Python Challenge

Your task is to write a Python script that calculates the age of an artefact based on its remaining Carbon-14 content. The script will include 3 steps:

Step 1: Input

Take as an input from the end user the current ratio of Carbon-14 to Carbon-12 in the artefact. (Note that as Carbon-12 is stable/does not decay over time, the ratio of Carbon-14 to Carbon-12 is pro-rata to the amount of carbon 14 remaining in the organism).

Step 2: Process
Apply the following Carbon-14 dating formula to estimate the age of the artefact.

Assuming the initial Carbon-14 to Carbon-12 ration is 1×10-12 = 1 ppt (parts per trillion), we can simplify the formula as follows

In the above formula:

  • The Carbon-14 ratio is expressed in parts per trillion (ppt).
  • t1/2 represents the Carbon-14 half-life, in other words the total number of years it takes for half of the radioactive carbon-14 atoms in a sample to decay into nitrogen-14 atoms. The half-life of Carbon-14 is approximately 5,730 years.

Using Python you can calculate a natural logarithm (ln) using math.log() from the math library:

import math
ln2 = math.log(2)
print("ln(2) = " + str(ln2))

Step 3: Output
Output the estimated age (in years) of the artefact.


After implementing your script using the online Python IDE below, you will use your script to estimate the age of the following 3 artefacts:

  • The Bakhshali manuscript (Carbon-14 Ratio: 0.878 ppt)
  • Tutankhamun’s tomb (Carbon-14 Ratio: 0.695 ppt)
  • The Sutton Hoo Anglo-Saxon Helmet (Carbon-14 Ratio: 0.844 ppt)

The Bakhshali Manuscript

The Bakhshali manuscript is an ancient Indian mathematical text written on birch bark that was found in 1881 in the village of Bakhshali, Mardan (near Peshawar in present-day Pakistan)

The carbon-14 ratio of the Bakhshali manuscript is 0.878 ppt.

The most recent Carbon dating tests from Oxford University revealed that the Bakshali manuscript dates from 799 – 1102 AD (9th – 11th century).

This means the manuscript would be between approximatively 900 to 1200 years old. Is this what your Python script is estimating?

Tutankhamun’s Tomb

Archaeologists have been able to use the Carbon-14 method to estimate the age of a few seeds found in the tomb of the Egyptian Pharaoh Tutankhamun who ruled over Ancient Egypt many thousands of years ago.

The carbon-14 ratio of the seeds: 0.695 ppt

Note that samples from Tutankhamun’s tomb were dated using radiocarbon dating techniques, with some samples dating to around 846 BC and 899 BC. These dates are significantly earlier than the traditionally accepted dates for Tutankhamun’s reign, which is generally placed around 1332–1323 BC.

This would mean that the seeds are approximatively 3,000 years old. Is this what your Python script is estimating?

The Sutton Hoo Anglo-Saxon Helmet

The Sutton Hoo helmet, discovered in an Anglo-Saxon ship burial at Sutton Hoo, Suffolk, UK, It is estimated to be around 1,400 years old, dating from the early 7th century (circa 620-625 AD). It was buried in a ship, along with many other artifacts, as part of an elaborate burial ritual. It is widely associated with Anglo-Saxon leader King Rædwald of East Anglia.

The carbon-14 ratio of wooden artefacts found next to the helmet: 0.844 ppt

unlock-access

Solution...

The solution for this challenge is available to full members!
Find out how to become a member:
➤ Members' Area

The K2-18b Exoplanet – Space Exploration Mission

In an exciting leap forward for space science, the James Webb Space Telescope recently discovered the exoplanet K2-18b, a world located in the habitable zone of its red dwarf star. With conditions that suggest it might support life, K2-18b has captured the attention of astronomers and astrobiologists alike. The planet’s potential to harbour life is a monumental discovery, opening new possibilities in the search for extra-terrestrial organisms and, perhaps, even life beyond Earth.

The Mission

To achieve this ambitious goal, we are launching a pioneering mission to send a probe to K2-18b using a newly discovered technology called “light year tele-transportation.” This ground-breaking method will enable us to traverse the vast expanse of space in a fraction of the time it would take with traditional propulsion systems.

Once the probe reaches K2-18b, it will deploy a rover equipped with an array of advanced instruments. The rover’s primary objectives are to explore the planet’s surface, collect atmospheric weather data, and create detailed 3D scans of the environment. To accomplish these tasks, the rover is preloaded with a library of functions that can be used to pre-program missions. These missions will be loaded onto the rover, which will then complete them autonomously.

The Challenge

Each mission algorithm is designed to perform a specific task, such as navigating to a waypoint, collecting atmospheric data, or creating a 3D scan of a particular area.

The rover has a limited power supply and data storage capacity, so it is crucial that we optimise its operations to ensure it can complete its missions without running out of power or exceeding its data storage limits.

Your task is to test 10 of the pre-coded mission algorithms to predict the power consumption and data usage of each mission. By doing so, you will help us ensure that the rover can operate efficiently and effectively on K2-18b.

You can access the 10 mission algorithms in the below frame. By testing these algorithms, you will play a crucial role in ensuring the success of our mission to explore this distant world. We count on you to check all 10 algorithms rigorously!
The K2-18b Exoplanet – Space Exploration MissionOpen in New Window

Tagged with: